View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20236_low_7 (Length: 241)
Name: NF20236_low_7
Description: NF20236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20236_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 12112430 - 12112234
Alignment:
| Q |
1 |
ttatgtcaaaatatacactcttctaccatgtaaaatatattagaaaaagttacactttactcatttcagagaagcttgaattatattgtcttacctctta |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
12112430 |
ttatgtcaaaatatatactcttctaccatgtaaaatatattagaaaaagttacactttactcattccagagaagcttgaattatatttccttacctctta |
12112331 |
T |
 |
| Q |
101 |
tgttaaaatcaactccctaagagcatctacaattttgaactatttagcaccacactagatgggcaccgtcattgtggagagaaaatgtttggtgttt |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12112330 |
tgttaaaatcaactcccttagagcatctacaattctgaattatttagcaccacactaaataggcaccgtcattgtggagagaaaatgtttggtgttt |
12112234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University