View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20238_high_4 (Length: 295)
Name: NF20238_high_4
Description: NF20238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20238_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 43110579 - 43110302
Alignment:
| Q |
1 |
tgaatctaaaaggctcaaggcttttctcaggaagcaagggaagttgtcttcagtttgtattaatcaaggttcatattacactttatgtacactatttaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43110579 |
tgaatctaaaaggctcaaggcttttctcaggaagcaagggaagttgtcttcagtttgtattaatcaaggttcatattacactttatgtacactgtttaag |
43110480 |
T |
|
| Q |
101 |
tcctgtgactaagtttcccttcatttaaatttcttgcatggtcttaatctctacctactgttatttatggtcaatgtcttttgtgtttgtttatggaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43110479 |
tcctgtgactaagtttcccttcatttcaatttcttgcatggtcttaatctctacctactgttatttatggtcaatgtcttttgtgtttgttgatggaaat |
43110380 |
T |
|
| Q |
201 |
gtttatgactcctattttgacattctcttttcaacactattattaaatgaaatcctatgttggtcccaccaatagagt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43110379 |
gtttatgactcctattttgacattctcttttcaacactattattaaatgaaatcctatgttggtcccaccaatagagt |
43110302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University