View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20238_low_9 (Length: 234)
Name: NF20238_low_9
Description: NF20238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20238_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 12 - 217
Target Start/End: Original strand, 34859159 - 34859364
Alignment:
| Q |
12 |
gaatattagttcaaaatagaacttcatctcgttgacatattagctggttagtctattttaagattacttgtttaaaattgttaatatgaaataaaccttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859159 |
gaatattagttcaaaatagaacttcatctcgttgacatattagctggttagtctattttaagattacttgtttaaaattgttaatatgaaataaaccttt |
34859258 |
T |
 |
| Q |
112 |
ttaagtaagctagcaagtcataccagactttnnnnnnnnnctcaggtcttagaaataaccgtaacataccaggttcagctttgttttttataaaatggtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34859259 |
ttaagtaagctagcaagtcataccagactttaaaaaaaaactcaggtcttagaaataactgtaacataccaggttcagctttgttttctataaaatggtt |
34859358 |
T |
 |
| Q |
212 |
agacct |
217 |
Q |
| |
|
|||||| |
|
|
| T |
34859359 |
agacct |
34859364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University