View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20239_high_12 (Length: 222)
Name: NF20239_high_12
Description: NF20239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20239_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 17998662 - 17998849
Alignment:
| Q |
20 |
tgtgactcaaaaaagagttgttgctacccaacaactggaaaacctgctgcagattttggaattcagggtctatggcctaattacaaagatggcacatacc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| || ||||||||||||| |
|
|
| T |
17998662 |
tgtgactcaaaaaagagttgttgctacccaacaactggaaaacctgctgcagattttggaattcatggtctgtggcctaattataaggatggcacatacc |
17998761 |
T |
 |
| Q |
120 |
cttctaactgtgatcctagtaacgcttttgacccatcccaggtatttcattatacatcaattaatattatttttcaaacaatcttttt |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17998762 |
cttctaactgtgatcctaataacgcttttgacccatcccaggtatttcattatacatcaattaatattatttttcaaacaatcttttt |
17998849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 35 - 175
Target Start/End: Original strand, 18006109 - 18006249
Alignment:
| Q |
35 |
agttgttgctacccaacaactggaaaacctgctgcagattttggaattcagggtctatggcctaattacaaagatggcacatacccttctaactgtgatc |
134 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
18006109 |
agttgttgctacccaacaactggaaagcctgctgcagattttggaattcatggtctctggcctaattataaggatggcacttacccttctaactgtgatc |
18006208 |
T |
 |
| Q |
135 |
ctagtaacgcttttgacccatcccaggtatttcattataca |
175 |
Q |
| |
|
| |||||||||||| | ||||| |||||| |||||| |||| |
|
|
| T |
18006209 |
ccagtaacgcttttaagccatctcaggtacttcattttaca |
18006249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University