View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20239_low_8 (Length: 376)
Name: NF20239_low_8
Description: NF20239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20239_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 266
Target Start/End: Original strand, 37807522 - 37807782
Alignment:
| Q |
5 |
gatatatgtctctctgtgcttcgattgttctctctaagattattatatactatagatctaacggcactcatactaagaattggtaggagtaagacaagct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37807522 |
gatatatgtctctctgtgcttcgattgttctctctaagattattatata---tagatctaacggcactcatactaagaattggtaggagtaagacaagct |
37807618 |
T |
 |
| Q |
105 |
attaccaaccagact--atagagaatatggtgagaaccccttattgtgacaaaaatggactaaggaaaggcacatggacacccgaggaagacaaaaagtt |
202 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37807619 |
attaccaaccagactctatagagaatatggtgagaaccccttattgtgacaaaaatggactaaggaaaggcacatggacacccgaggaagacaaaaagtt |
37807718 |
T |
 |
| Q |
203 |
gattgcttatgtaactaggtatggctgttggaattggggacaactacctagatttgcaggtata |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
37807719 |
gattgcttatgtaactaggtatggctgttggaattggcgacaattacctaaatttgcaggtata |
37807782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 129 - 312
Target Start/End: Original strand, 37788683 - 37788863
Alignment:
| Q |
129 |
atggtgagaaccccttattgtgacaaaaatggactaaggaaaggcacatggacacccgaggaagacaaaaagttgattgcttatgtaactaggtatggct |
228 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| | || ||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37788683 |
atggtgagaacccctt---gtgacaataatggattgagaaaaggttcatggacacatgaggaagacaaaaagttgattgcttatgttactaggtatggct |
37788779 |
T |
 |
| Q |
229 |
gttggaattggggacaactacctagatttgcaggtataagaaaaggttaacactaagatatcataaacttttgttggataggta |
312 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788780 |
gttggaattggcgacaactacctagatttgcaggtataagaaaaggttaacactaagatatcataaacttttgttggataggta |
37788863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University