View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024-Insertion-20 (Length: 172)
Name: NF2024-Insertion-20
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024-Insertion-20 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 8 - 172
Target Start/End: Complemental strand, 41751465 - 41751302
Alignment:
| Q |
8 |
atagttgcgtggcattttgaatttgcccctattgtgtattatgaaatatgaatcctcaaatctctatttatgtatttttaattgtctttttcataatttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41751465 |
atagttgcgtggcattttgaatttgcccctattgtgtattatgaaatatgaatcctcaa-tctctatttatgtatttttaattgtctttttcataatttt |
41751367 |
T |
 |
| Q |
108 |
aaagagcatacggtgacatgcactcacatgttaaatgagaaattacaaatacaaatttacgcatc |
172 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41751366 |
aaagagcacgcggtgacacacactcatatgttaagtgagaaattacaaatacaaatttgcgcatc |
41751302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University