View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024-Insertion-25 (Length: 60)
Name: NF2024-Insertion-25
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024-Insertion-25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 55
Target Start/End: Original strand, 2632821 - 2632862
Alignment:
| Q |
14 |
gcagctatgtttgtgcattgtctgcctactgctaacatagta |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2632821 |
gcagctatgtttgtgcattgtctgcctactgctaacatagta |
2632862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University