View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20240_high_14 (Length: 323)

Name: NF20240_high_14
Description: NF20240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20240_high_14
NF20240_high_14
[»] chr5 (1 HSPs)
chr5 (18-66)||(30411815-30411863)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 30411863 - 30411815
Alignment:
18 cccaaaattgctaaaacaaattgatgatgataaagcttcaacaccaatt 66  Q
    |||| |||||||||||||||||||||||||||||| || ||||||||||    
30411863 cccacaattgctaaaacaaattgatgatgataaaggtttaacaccaatt 30411815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University