View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20240_high_19 (Length: 262)
Name: NF20240_high_19
Description: NF20240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20240_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 241
Target Start/End: Complemental strand, 43025890 - 43025656
Alignment:
| Q |
3 |
ttatgtctcaacaccgttaatttcaaatttaagataaaaacgatggtttagaaaaaggctggtttctagttctagcatataaaaatagaaacataactga |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43025890 |
ttatgtctcaacacctttaatttcaaatttaagataaaaacgatggtttagaaaaaggctggtttctagttctatcatataaaaatagaaacataactga |
43025791 |
T |
|
| Q |
103 |
attgagggttttgcagattggaagt-aattctgatttgtatatgaaacggttgctgctcctgctaggtcattcttcacgtttctaaagttccatgtacaa |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43025790 |
attgagggttttgcagattggaagtaaattctgatttgtatatgaaacggttg------ctgctaggtcattcttcacgtttctaaagttccatgtacaa |
43025697 |
T |
|
| Q |
202 |
caaagatcggcaatt-aacggtatagaattgagaaagttat |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
43025696 |
gaaagatcggcaattaaacggtatagaattgagaaggttat |
43025656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 156
Target Start/End: Complemental strand, 22258054 - 22257972
Alignment:
| Q |
81 |
ataaaaatagaaacataactgaattgagggttttgcagattgga-------agtaattctgatttgtatatgaaacggttgct |
156 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22258054 |
ataaaaatagaaacataattgaattaagggttttgcagattggatgtaaattgtaattctgatttgtatatgaaacggttgct |
22257972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 84 - 156
Target Start/End: Complemental strand, 30794115 - 30794036
Alignment:
| Q |
84 |
aaaatagaaacataactgaattgagggttttgcagattggaa-------gtaattctgatttgtatatgaaacggttgct |
156 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
30794115 |
aaaatagaaacataattgaattaagggttttgcagattggaaataaattgtaattctgatttgtatataaaacggttgct |
30794036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University