View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20240_high_7 (Length: 412)

Name: NF20240_high_7
Description: NF20240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20240_high_7
NF20240_high_7
[»] chr3 (2 HSPs)
chr3 (244-375)||(26225615-26225756)
chr3 (102-159)||(26225835-26225892)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 244 - 375
Target Start/End: Complemental strand, 26225756 - 26225615
Alignment:
244 gcaacagcgaatacgattatggttttgattatgatgattatgaaagatgttt-----attgtttat-----tgttaatagtagcaggaatgacgtcagtt 333  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||| |     ||| | |||     || ||||||||||||||||||||||||||    
26225756 gcaacagcgaatacgattatggttttgattatgatgattatgaaggatgtatctatgattttatatgaaagtgataatagtagcaggaatgacgtcagtt 26225657  T
334 catgttaaggtaacaattgcttttgattatatatcctgagtt 375  Q
    ||||||||||||||||||||||||||||||||||||||||||    
26225656 catgttaaggtaacaattgcttttgattatatatcctgagtt 26225615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 26225892 - 26225835
Alignment:
102 gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26225892 gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta 26225835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University