View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20240_low_24 (Length: 247)
Name: NF20240_low_24
Description: NF20240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20240_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 32189136 - 32188902
Alignment:
| Q |
13 |
tctccaatcaactacctttgttcgcttatctaggaaaatgcagttcgtatttatttgccattttaaaagttcgataaggagagtgtgcgcggtcgatctc |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32189136 |
tctccaatcaactatctttgttcgcttatctaggaaaatgtagttcgtatttattttccgttttaaaagttcgatgaggagagtgtgcgcggtcgatctc |
32189037 |
T |
 |
| Q |
113 |
cttattgccgaggcatttggagtgcgtatgggtctcagtattgtcatcgcgagctttgttgttaagattgcgaccgcaagattgatagcgagttggtctt |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32189036 |
cttattgccgaggcatttggagtgtgtatgggtctcagtattgtcatcgcgagctttgttgttaagattgcaaccgcaagattgatagcgagttggtctt |
32188937 |
T |
 |
| Q |
213 |
tctagcattaaataagaggaaaaactttgaaggtt |
247 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |
|
|
| T |
32188936 |
tctagcgttaactaagaggaaaaactttgaaggtt |
32188902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University