View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20241_low_1 (Length: 414)
Name: NF20241_low_1
Description: NF20241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20241_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 189 - 397
Target Start/End: Original strand, 17658619 - 17658829
Alignment:
| Q |
189 |
cttgctctatgcgtcttgtgcagatgtagcggttaataaattttggttgtttnnnnnnnng--ctataacaggaaattgaattgatcttattggaatttt |
286 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
17658619 |
cttgctctgtgcgtcttgtgcagatgtagcggttaataaattttggttgtttcaaaaaaaaaactataacaggaaattggattgatcttgttggaatttt |
17658718 |
T |
|
| Q |
287 |
aggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaat |
386 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17658719 |
aggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaat |
17658818 |
T |
|
| Q |
387 |
agccttcacag |
397 |
Q |
| |
|
||||||||||| |
|
|
| T |
17658819 |
agccttcacag |
17658829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 45364819 - 45364757
Alignment:
| Q |
10 |
attgctaaactgttagccataagcataaagcaaagaagctttttattggagtttgattagatt |
72 |
Q |
| |
|
|||| |||||||||||| || || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45364819 |
attgttaaactgttagctgtaggcttaaagcaaagaagctttttattggagtttgattagatt |
45364757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 45376059 - 45375997
Alignment:
| Q |
10 |
attgctaaactgttagccataagcataaagcaaagaagctttttattggagtttgattagatt |
72 |
Q |
| |
|
|||| |||||||||||| || || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45376059 |
attgttaaactgttagctgtaggcttaaagcaaagaagctttttattggagtttgattagatt |
45375997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Complemental strand, 45383638 - 45383576
Alignment:
| Q |
10 |
attgctaaactgttagccataagcataaagcaaagaagctttttattggagtttgattagatt |
72 |
Q |
| |
|
|||| |||||||||||| || || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383638 |
attgttaaactgttagctgtaggcttaaagcaaagaagctttttattggagtttgattagatt |
45383576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University