View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_29 (Length: 347)
Name: NF20242_high_29
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 21872314 - 21872461
Alignment:
| Q |
18 |
taaggtagagttgaagaaagtaaaagagtgataaagggattaaactaccgaggagaaaaccgttgcgaccttgaactacggcttgaagaggaacgataag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872314 |
taaggtagagttgaagaaagtaaaagagtgacaaagggattaaactacccaggagaaaaccgttgcgaccttgaactacggcttgaagaggaacgataag |
21872413 |
T |
|
| Q |
118 |
tttcattccggttcgagaggatgaagaagaagaggaaggtggttcaga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872414 |
tttcattccggttcgagaggatgaagaagaagaggaaggtggttcaga |
21872461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University