View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_44 (Length: 288)
Name: NF20242_high_44
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 26351174 - 26351440
Alignment:
| Q |
1 |
aaagaattgaaattacaccttgaatccagttatgccaacggttgcgaatagtgtatggaactaaggatgagtccctaaaaacctgcaaagcactttaagg |
100 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26351174 |
aaagaattgaaattacaccttgagtacaattatgccaacggttgcgaatagtgtatggaactaaggatgagtccctaaaaacctgcaaagcactctaagg |
26351273 |
T |
 |
| Q |
101 |
atcaccttccacctatagatgatgccaatgatgttgaaccgcatattccaaagcaaacatgaagagtctatagaagatccgattcaaaaccagaaagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
26351274 |
atcaccttccacctatagatgatgccaatgatgttgaaccgcatattccaaagcaaacatgaagagtc--taaaagatccgattcaaaaacagaaagagg |
26351371 |
T |
 |
| Q |
201 |
actcatgttgcaacttctgtctctcagcaacaggatacatgcactaattggattaacacacaagaaatc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26351372 |
actcatgttgcaacttctgtctctcagcaacaggatacatgcactaattggattaacacacaagaaatc |
26351440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University