View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_57 (Length: 246)
Name: NF20242_high_57
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 24752421 - 24752652
Alignment:
| Q |
1 |
ttctatgaaccttcttatgtacatggcaccagtggctgttgcaatcctacttcctgcttcaattataatggaggaagatgtgcttggaattaccattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24752421 |
ttctatgaaccttcttatgtacatggcaccagtggctgttgcattcctacttcctgcttcaattataatggaggaagatgtgcttggaattaccattcaa |
24752520 |
T |
 |
| Q |
101 |
cttgctagagaagattcaactattgtgtggttacttattttcaactccacactggcatattttgtcaacttgaccaattttttagtcacaaagcacacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24752521 |
cttgctagagaagattcaactattgtgtggttacttattttcaactccacactagcatattttgtcaacttgaccaattttttagtcacaaagcacacta |
24752620 |
T |
 |
| Q |
201 |
gtgctttaacacttcaagtaattatagtttct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24752621 |
gtgctttaacacttcaagtaattatagtttct |
24752652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 35018385 - 35018437
Alignment:
| Q |
140 |
ttcaactccacactggcatattttgtcaacttgaccaattttttagtcacaaa |
192 |
Q |
| |
|
||||| ||| |||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
35018385 |
ttcaattccgcacttgcatattttgtcaatctgaccaattttttggtcacaaa |
35018437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University