View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_62 (Length: 238)
Name: NF20242_high_62
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_62 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 25654990 - 25655210
Alignment:
| Q |
18 |
ggatggacattaggatggacatgggccaagaaagaaatcatatgggccatgatgggagcacaggcaacagaacaaggagattgttcaaagttcaagttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25654990 |
ggatggacattaggatggacatgggccaagaaagaaataatatgggccatgatgggagcgcaggcaacagaacaaggcgattgttcaaagttcaagttaa |
25655089 |
T |
 |
| Q |
118 |
agattcctcatagttgcaagagaagtcctcaagttgttgacttattaccaggagcatcttacaatatgcaatacacgaactgttgcaaaggtggtgtgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25655090 |
agattcctcatagttgcaagagaagtcctcaagttgttgacttattaccaggagcatcttacaatatgcaatacacgaattgttgcaaaggtggtgtgct |
25655189 |
T |
 |
| Q |
218 |
aacatcgtggggacaggatcc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25655190 |
aacatcgtggggacaggatcc |
25655210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 25662454 - 25662358
Alignment:
| Q |
16 |
caggatggacattaggatggacatgggccaagaaagaaatcatatgggccatgatgggagcacaggcaacagaacaaggagattgttcaaagttcaa |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||| || || ||| | || ||| |||||||||| || ||||||||||||||||||||||||| ||||| |
|
|
| T |
25662454 |
caggatggacattaggttggacatgggcgaaaaaggaagtaatttggaacatgatgggaagccaaacaacagaacaaggagattgttcaaaattcaa |
25662358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 112
Target Start/End: Complemental strand, 5554745 - 5554651
Alignment:
| Q |
18 |
ggatggacattaggatggacatgggccaagaaagaaatcatatgggccatgatgggagcacaggcaacagaacaaggagattgttcaaagttcaa |
112 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| | |||||| | ||| ||||| || | ||||| ||||||||||||||||||||||| |
|
|
| T |
5554745 |
ggatggaccttaggatggacatgggctaagaaagaagttatatggtcagtgacaggagctcaaaccacagagcaaggagattgttcaaagttcaa |
5554651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 5549549 - 5549634
Alignment:
| Q |
18 |
ggatggacattaggatggacatgggccaagaaagaaatcatatgggccatgatgggagcacaggcaacagaacaaggagattgttc |
103 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| | |||||| |||| | ||| ||| |||| ||||||||||||||||| |
|
|
| T |
5549549 |
ggatggtcattaggatggacatgggcaaagaaagaggtaatatggaacatggtaggaagtcagacaactgaacaaggagattgttc |
5549634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 112
Target Start/End: Complemental strand, 5012593 - 5012499
Alignment:
| Q |
18 |
ggatggacattaggatggacatgggccaagaaagaaatcatatgggccatgatgggagcacaggcaacagaacaaggagattgttcaaagttcaa |
112 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| | |||||| | ||| | ||| | || |||| || ||||||||||| ||||| ||||| |
|
|
| T |
5012593 |
ggatggacattaggatggtcatgggctaagaaagaagttatatggtcaatggtaggatctcaaacaactgagcaaggagattgctcaaaattcaa |
5012499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University