View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_70 (Length: 220)
Name: NF20242_high_70
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 24247505 - 24247709
Alignment:
| Q |
1 |
cgcagctgcctcgtggtggcggtagtttcttcttccatcactgaatcagaagaagtggcgtcgttttggaatgaaaatgagtgttgggtaagggttagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24247505 |
cgcagctgcctcgtggtggcggtagtttcttcttccatcactgaatcagaagaagtggcgtcgttttggaatgaaaatgagtgttgggtaagggttagga |
24247604 |
T |
 |
| Q |
101 |
aaaaattaggaaatgatatcttggcaagtaaggttggtgactagtgaggataagaaacatggttaaataatgaagtaccaaccaggctagttaacgaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
24247605 |
aaaaattaggaaatgatatcttggcaagtaaggttggtgactggtgaggataagaaacatggttaaataatgaagtaccaacgaggctagttaatgaagt |
24247704 |
T |
 |
| Q |
201 |
ttcat |
205 |
Q |
| |
|
||||| |
|
|
| T |
24247705 |
ttcat |
24247709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University