View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_74 (Length: 213)
Name: NF20242_high_74
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 37878570 - 37878763
Alignment:
| Q |
1 |
tcaatcctgtgtgattataattttgttggtccatttgtcatgttcttatatgtatgtacagcttgaagtttgaacttcaccttttagcaatttggcacga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37878570 |
tcaatcttgtgtgattataattttgttggtccatttgtcatgttcttacatgtatgtacagcttgaagtttgaacttcaccttttagcaatttggcacga |
37878669 |
T |
 |
| Q |
101 |
gtaatatatggacaatatgaagtatagtggagaataactacaactacacaacaaattatgtgtctttgttgagcatgcaattctttccttcttt |
194 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37878670 |
gcaatatatggacaatatgaagtttagtggagaataactacaactacacaacaaattatgtgtctttgttgagcatgcaattctttccttcttt |
37878763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University