View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_high_75 (Length: 211)
Name: NF20242_high_75
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_high_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 23 - 194
Target Start/End: Original strand, 654633 - 654806
Alignment:
| Q |
23 |
aatgctttgacaattgtattgttgaactgttatcacagtacattatgctgccttcttctcctttatgcccaagtttttcgagtagcctcgtaagccaaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
654633 |
aatgctttgacaattgtattgttgaactgttatcacagtacattatgctgccttcttctcctttatgcccaagtttttcgagtagccttgtaagccaaat |
654732 |
T |
|
| Q |
123 |
gtattgacatgcgcaagaagc--cggcaatatactcagcttcagtggtagataatgtaactacatgctgcttct |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
654733 |
gtattgacatgcgcaagaagccgcggcaatatactcaacttcagtggtagataatgtaactacaagctgcttct |
654806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University