View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_31 (Length: 350)
Name: NF20242_low_31
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 24752336 - 24752141
Alignment:
| Q |
1 |
accaacaagtttaaaatacaatgtaagggtagttttgagatcatta---cccttcagaagatagtaagactccttgaagtactgttttgagtgccctggc |
97 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24752336 |
accaacaggtttaaaatacaatggaaggatagttttgagatcattattacccttcagaagatagtaagactccttgaagtactgttttgagtgctctggc |
24752237 |
T |
 |
| Q |
98 |
tgctgtagcaccaatgcacattataaatccaaatagatgaaaacttggttctcccttcatccatgtaacacaaaagacaaataataaatcaacatg |
193 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24752236 |
tgctgtagcactgatgcacattataaatccaaatagatgaaaacttggttctcccttcatccatgtaacacaaaagacaaataataaatcaacatg |
24752141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 334
Target Start/End: Complemental strand, 24752121 - 24752088
Alignment:
| Q |
301 |
atcacatttccatccacaataataaggacattga |
334 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24752121 |
atcacattttcatccacaataataaggacattga |
24752088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 5778902 - 5778938
Alignment:
| Q |
117 |
attataaatccaaatagatgaaaacttggttctccct |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5778902 |
attataaatccaaatagatgaaaacttggttcaccct |
5778938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University