View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_34 (Length: 336)
Name: NF20242_low_34
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 13155195 - 13155530
Alignment:
| Q |
1 |
tatctgttttattggacggttcaaca-tgtttttctgctgctgctactgtgtttttaggctgctcnnnnnnngggtttggtggatgttttggggtagctg |
99 |
Q |
| |
|
||||||||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13155195 |
tatctgttttattgggctgttcagcagtgtttttctgctgctgctactgtgtttttaggctgctcttttttcgggtttggtggatgttttggggtagctg |
13155294 |
T |
|
| Q |
100 |
atcagttttaggccctatgtattattggtgttttgctgctctcctctttatacgtcttg-------tggtgtgttaatatatataagcggtttcaaaac- |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13155295 |
atcagttttaggccctgtgtattattggtgttttgctgctctcctctttatacgtcttgtataatttggtgtgttaatatatataagcggtttcaaaaca |
13155394 |
T |
|
| Q |
192 |
-------nnnnnnnnnncttgcaagttggttaacaactccaatgaatttatggaattgttgttctcgttgtttatggttccttttgagagcagggtaagg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13155395 |
aaaaaaaaaaaaaaaaacttgcaagttggttaacaactccaatgaatttatggaattgttgttctcgttgtttatggttccttttgagagcagggtaagg |
13155494 |
T |
|
| Q |
285 |
tagcttgatgtaattgggaagttccctacaaatatt |
320 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
13155495 |
tagcttgatgtaactggaaagttccctacgaatatt |
13155530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University