View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_36 (Length: 329)
Name: NF20242_low_36
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 9196125 - 9195809
Alignment:
| Q |
1 |
aaccttaggtataggttttcatctttgctgttcgacgctcccaggctttcggcattttctcagaactttgtcaaatggttgatggaatcttcatgatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9196125 |
aaccttaggtataggttttcatctttgctgttcgatgctcccaggctttcggcatttttgcataactttgtcagatggttgatgggatcttcatgatcca |
9196026 |
T |
|
| Q |
101 |
tttcagtgaacgaatttacacgcagaagtggaataacttttgtcttgatctccatttgtcgctgattgtttttaggcttggatgatcaggcgtatctcct |
200 |
Q |
| |
|
|||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9196025 |
tttcggtgaacgaatttacgagcagaagttgaataacttttgtcttgatctccatttgtcgctgattgtttttaggcttggatgatcaggcgtatctcct |
9195926 |
T |
|
| Q |
201 |
tagac--ttgttgttcatcgtcaatgtcgttgtttctgcattattggccatgcttcttgttgttttttgcaacgattgtcttcgttactttgcttgccgt |
298 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9195925 |
tagacagttgttgttcatcgtcaatgtcgttgtttctgcattattggccatgcttcttgttgttttttgcaacgactgtcttcgtttctttgcttgccgt |
9195826 |
T |
|
| Q |
299 |
cggtttttccttctagt |
315 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9195825 |
cggtttttccttctagt |
9195809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University