View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_64 (Length: 249)
Name: NF20242_low_64
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_64 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 31699040 - 31699288
Alignment:
| Q |
1 |
ttatgaggtatggtaggaacttattaagtgtggcatggggaatataattagattgcagatgaacggagtctgttgataggtatacagcaatgtaaaaact |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31699040 |
ttatgaggtagggtaggaacttattaagtgtggcatggggaatataattagattgctgatgaacggagtctgttgataggtatacagcaatgcaaaaact |
31699139 |
T |
 |
| Q |
101 |
gaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcgatttatattcaaccaaaccattttggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
31699140 |
gaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttatactatttgtcaatttattttcaaccaaaccattttggtt |
31699239 |
T |
 |
| Q |
201 |
agatgtgctagtcaatctatggatgatgccaaatttattgagaaattgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699240 |
agatgtgctagtcaatctatggatgatgccaaatttattgagaaattgt |
31699288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University