View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_66 (Length: 245)
Name: NF20242_low_66
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 28181276 - 28181219
Alignment:
| Q |
1 |
agtgtttatttgattgtggtataatccaaaagatttacaaccaaataattataataag |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
28181276 |
agtgtttatttgattgtggtataatccaaaagatttacaaccaaataaatatactaag |
28181219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 230
Target Start/End: Original strand, 27992148 - 27992186
Alignment:
| Q |
192 |
atatggagtaccgtgaatgaattggtaaatgcaataagt |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
27992148 |
atatggagtaccgtgaatgaattagtaaaagcaataagt |
27992186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 230
Target Start/End: Original strand, 28078681 - 28078719
Alignment:
| Q |
192 |
atatggagtaccgtgaatgaattggtaaatgcaataagt |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28078681 |
atatggagtaccgtgaatgaattagtaaaagcaataagt |
28078719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 230
Target Start/End: Complemental strand, 28181213 - 28181183
Alignment:
| Q |
200 |
taccgtgaatgaattggtaaatgcaataagt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28181213 |
taccgtgaatgaattggtaaatgcaataagt |
28181183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 146
Target Start/End: Complemental strand, 28175161 - 28175128
Alignment:
| Q |
113 |
taagataaaaataacccacatcgaagttgataga |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
28175161 |
taagataaaaataacccaaatcgaagttgataga |
28175128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University