View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20242_low_80 (Length: 216)
Name: NF20242_low_80
Description: NF20242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20242_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 34627179 - 34627360
Alignment:
| Q |
18 |
aggataataaagatttgaggatggagggttttgagactataaggaaggcaaaagaagtggtggagaaaaagtgtcctactgtggtgtcctgtgcagatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34627179 |
aggataataaagatttgaggatggagggttttgagactataaggaaggcaaaagaagtggtggagaaaaagtgtcctactgtggtgtcctgtgcagatat |
34627278 |
T |
|
| Q |
118 |
tcttgcaattgcagcgagagattttgtgcacttagtaagttatctgttctttgtttcaacttcatatataatgattaccact |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34627279 |
tcttgcaattgcagcaagagattttgtgcacttagtaagttacctgttctttgtttcaacttcatatataatgattaccact |
34627360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University