View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_high_10 (Length: 326)
Name: NF20243_high_10
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 7684959 - 7685276
Alignment:
| Q |
1 |
tccttttgaaaagccatagaaatcccaagccattgacatgtagcgtaccaaacacctgaagaagctggactataaccaaagttctataccaccaatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7684959 |
tccttttgaaaagccatagaaatcccaagccattgacatgtagcgtaccaaacacctgaagaagctggactataaccaaagttctataccaccaatttga |
7685058 |
T |
|
| Q |
101 |
gcatatatctgggcgtgaagtttggtttttgaaacccatttaaatgacttcgaggggctcttctccattttcattcttgcagcttcactgagttttgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7685059 |
gcatatatctgggcgtgaagtttggtttttgaaacccatttaaatgacttcgaggggctcttctccattttcattcttgcagcttcactgagttttgcaa |
7685158 |
T |
|
| Q |
201 |
catatctttgattaggtctaattaagagccttgtacattcacttggaatacaatcaatataaaaaactctagaatttcaccgccnnnnnnnnngtccttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7685159 |
catatctttgattaggtctaattaagagccttgtacattcacttggaatacaatcaatataaaaaactctagaatttcaccgcctttttttttgtccttc |
7685258 |
T |
|
| Q |
301 |
gtgtattttgttcatctc |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7685259 |
gtgtattttgttcatctc |
7685276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University