View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_high_6 (Length: 364)
Name: NF20243_high_6
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 18 - 350
Target Start/End: Complemental strand, 45888776 - 45888444
Alignment:
| Q |
18 |
aatgaaacttcagtttcatcaaattccacgtcagcaacaccacaatcacttccccagtaatgtgccggtgacattagcaccatgtttctcaaatactccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45888776 |
aatgaaacttcagtttcatcaaattccacgtcagcaacaccacaatcacttccccagtaatgtgccggtgacattagcaccatgtttctcaaatactccg |
45888677 |
T |
|
| Q |
118 |
gcactgtatcctcttcctcctcccgttgctccatcaccgtctccgacaccgccactgtcgacgaaggctcactatccttcctctcttcactattctcaaa |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45888676 |
gcaccgtatcctcttcctcctcccgttgctccatcaccgtctccgacaccgccactgtcgacgaaggctcactatccttcctctcttcactattctcaaa |
45888577 |
T |
|
| Q |
218 |
cacactctccggcctgaaagcctccgctgcctcagccgccgccttttgaatatcccttgcttccgacgtagccggaaccggcaacttccaagcagaatca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45888576 |
cacactctccggcctgaaagcctccgctgcctcagccgccgccttttgaatatcccttgcttccgacgtagccggaaccggcaacttccaagcagaatca |
45888477 |
T |
|
| Q |
318 |
gcaaagttaagacaagcagaccttcctctcagt |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45888476 |
gcaaagttaagacaagcagaccttcctctcagt |
45888444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University