View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_low_17 (Length: 255)
Name: NF20243_low_17
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 17 - 255
Target Start/End: Complemental strand, 7984308 - 7984072
Alignment:
| Q |
17 |
atatatagcggcaacaaataatttacgtggtaaagtaattgggaatgaacttcttatgttcaattaaggtcatgtttagtttcaatagtgtgtgttgaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7984308 |
atatatagcggcaacaaataatttacatggtaaaataatcgggaatgaacttcttatgttcaattatggtcatgtttagtttcaatagtgtgt--tgaaa |
7984211 |
T |
|
| Q |
117 |
actagagatagatttgttttgtgtgacaaatgttagtatgttaattattattagtatttttaatcgtgtgtattgaaaagtagagatatatttattttaa |
216 |
Q |
| |
|
| |||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7984210 |
agtagaaatagatttattttgtgtgacaaatgttagtatgttaattgttattagtatttttaatcgtgtttattgaaaagtagagatagatttattttaa |
7984111 |
T |
|
| Q |
217 |
atgataaatgttagtatgttaaatcctattttgaaaaac |
255 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
7984110 |
atgacaaatgttagtatattaaatcctattttgaaaaac |
7984072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University