View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_low_19 (Length: 241)
Name: NF20243_low_19
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 32681814 - 32682037
Alignment:
| Q |
22 |
tatgagaggttttttaatagggaaggcagaatagacaacaatacccatatgaaagaatctttgattcaaggcctttttggtatcattgtagtgcaagcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681814 |
tatgagaggttttttaatagggaaggcagaatagacaacaatacccatatgaaagaatctttgattcaaggcctttttggtatcattgtagtgcaagcaa |
32681913 |
T |
 |
| Q |
122 |
gaaacatgtaacagagaagggaaatggaaatttcattttccctctcaatttttcattaccattctcaaagttttggttgtgaattg----------tata |
211 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32681914 |
ga---atgtaacagagaagggaaatggaaatttcattttccctctcaatttttcattaccattctcaaagttttggttgtgaattgtgattactcctata |
32682010 |
T |
 |
| Q |
212 |
gagtatataaggtaaggactatatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32682011 |
gagtatataaggtaaggactatatatt |
32682037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University