View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_low_24 (Length: 213)
Name: NF20243_low_24
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 37638870 - 37639065
Alignment:
| Q |
1 |
gattgggcaacacaaggtggtcgtgtgaaaacagattggactcatgcacctttcattgctacctacaaagattttgagatcaatggttgtgaggttgctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37638870 |
gattgggcaacacaaggtggtcgtgtgaaaacagattggactcatgcacctttcattgctacctacaaagattttgagatcaatgcttgtgaggttgctg |
37638969 |
T |
 |
| Q |
101 |
tgccagtgacatcaactgaaaatgctaagaaatgtgctagtagtgaagataaaaaatactggtgggatgaaccaatgttgaatgaactcactattc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37638970 |
tgccagtgacatcaactgaaaatgctaagaaatgtgctagtagtgaagataaaaaatactggtgggatgaaccaatgttgaatgaactcactattc |
37639065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 15796837 - 15796901
Alignment:
| Q |
1 |
gattgggcaacacaaggtggtcgtgtgaaaacagattggactcatgcacctttcattgctaccta |
65 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||| |||||||||| || ||||| ||||| |
|
|
| T |
15796837 |
gattgggcaacacaaggaggaagagtgaaaacagattggtctcatgcaccctttattgcaaccta |
15796901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University