View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20243_low_3 (Length: 453)

Name: NF20243_low_3
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20243_low_3
NF20243_low_3
[»] chr3 (3 HSPs)
chr3 (155-248)||(24496941-24497034)
chr3 (391-437)||(24497041-24497087)
chr3 (62-97)||(24496902-24496937)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 24496941 - 24497034
Alignment:
155 ttcaatagttatcaaatacagatcaacataacaaaaaattcatataatatcaccataattcattgcaaggcagaaacataaagagtgacattaa 248  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24496941 ttcaatagttatcaaatacagatcaacataacaaaaaatacatataatatcaccataattcattgcaaggcagaaacataaagagtgacattaa 24497034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 391 - 437
Target Start/End: Original strand, 24497041 - 24497087
Alignment:
391 taatcagtgagcaaattataaacttaaaagaaataaaaagaacataa 437  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||    
24497041 taatcagtgagcaaattataaacttaaaagaaataaaaaggacataa 24497087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 24496937 - 24496902
Alignment:
62 tggcattgaattgaattctcaatttctagtttctca 97  Q
    ||||||||||||||||||||||||||||||||||||    
24496937 tggcattgaattgaattctcaatttctagtttctca 24496902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University