View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_low_3 (Length: 453)
Name: NF20243_low_3
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 24496941 - 24497034
Alignment:
| Q |
155 |
ttcaatagttatcaaatacagatcaacataacaaaaaattcatataatatcaccataattcattgcaaggcagaaacataaagagtgacattaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24496941 |
ttcaatagttatcaaatacagatcaacataacaaaaaatacatataatatcaccataattcattgcaaggcagaaacataaagagtgacattaa |
24497034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 391 - 437
Target Start/End: Original strand, 24497041 - 24497087
Alignment:
| Q |
391 |
taatcagtgagcaaattataaacttaaaagaaataaaaagaacataa |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24497041 |
taatcagtgagcaaattataaacttaaaagaaataaaaaggacataa |
24497087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 24496937 - 24496902
Alignment:
| Q |
62 |
tggcattgaattgaattctcaatttctagtttctca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24496937 |
tggcattgaattgaattctcaatttctagtttctca |
24496902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University