View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20243_low_5 (Length: 413)
Name: NF20243_low_5
Description: NF20243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20243_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 68 - 328
Target Start/End: Original strand, 36336395 - 36336655
Alignment:
| Q |
68 |
ctggttgtcagatgttgatccaacaattggagccactagctgagcagcagataatggggatgtatggactgaggcattcttctcagcaagcagaggaagc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36336395 |
ctggttgtcagatgttgatccaacaattggagccactagctgagcagcagataatggggatgtatggactgaggcattcttctcagcaagcagaggaagc |
36336494 |
T |
 |
| Q |
168 |
tctctcacaaggacttgaccagttgcaacagtctcttgttgacaccattgctggaggaccccttgttgatggtgttcaacaaatggttgttgctataggc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36336495 |
tctctcacaaggacttgaccagttgcaacagtctcttgttgacaccattgctggaggaccccttgttgatggtgttcaacaaatggttgttgctataggc |
36336594 |
T |
 |
| Q |
268 |
aagcttgccaatcttgaaggttttcttcgccaggtacatagtagaatttaattcatatata |
328 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36336595 |
aagctttccaatcttgaaggttttcttcgccaggtacatagtagaatttaattcatatata |
36336655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University