View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20244_high_14 (Length: 306)
Name: NF20244_high_14
Description: NF20244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20244_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 49726141 - 49726429
Alignment:
| Q |
1 |
accgctaaccaccaatgccactgttttcagaatttctcgttatcccaaaaccaaaccacctttgcgtagagaaattcatgctccgtgtagtagtagacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49726141 |
accgctaaccaccaatgccactgttttcagaatttctcgttatcccaaaaccaaaccacctttgcgtagagaaattcatgctccgtgtagtagtagacca |
49726240 |
T |
|
| Q |
101 |
cgcaaattcgatttatcaactaatttgaaattaacagaatcatccaatttgatggctagtgataccaccgatgagttaatggaaaaatacgagcatgcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49726241 |
cgcaaattcgatttatcaactaatttgaaattaacagaatcatccaatttgatggctagtgataccaccgatgagttaatggaaaaatacgagcatgcga |
49726340 |
T |
|
| Q |
201 |
aacatgctgcattagctactatctcttttagggaaaagggaaaggtaaaagataatattaaggaagttgttgttttggaagattcaaat |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49726341 |
aacatgctgcattagctactatctcttttagggaaaagggaaaggtaaaagataatattaaggaagttgttgttttgaaagattcaaat |
49726429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University