View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20244_high_23 (Length: 230)
Name: NF20244_high_23
Description: NF20244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20244_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 54958186 - 54958416
Alignment:
| Q |
1 |
aggatagggataaggatgatactctgaagatgttgctagaagccaagacaaatgatgcacaagaaccattagctattgcagctgatattggatatgatga |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
54958186 |
aggatagggacaaggatgatactctgaagatgttgctagaagccaagacaagtgatgcacaagaaccattagcaattgctgctgatattggatatgatga |
54958285 |
T |
 |
| Q |
101 |
gaattgcaaacaggttgtggaacttgttgtcaaagagtatgga---cgcattgatgttcttgtcaacaatgcagctgaacaacacctcaaaaactcaata |
197 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54958286 |
gaattgtaaacaggttgtggaacttgttgtaaaagaatatggaagcagcattgatgttcttgtcaacaatgcagctgaacaacacctcagaaactcaata |
54958385 |
T |
 |
| Q |
198 |
gaggaaatcactgagcaacagcttgaaagag |
228 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
54958386 |
gaggaaatcactgaacaacagcttgaaagag |
54958416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University