View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20244_low_14 (Length: 311)
Name: NF20244_low_14
Description: NF20244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20244_low_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 311
Target Start/End: Complemental strand, 45456175 - 45455881
Alignment:
| Q |
17 |
catgcaccgcatcccttttcttgtgtattttttatcgttacgttctggggatatannnnnnnnnnncattatattctcagctttaacctttgcaattcaa |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45456175 |
catgcaccgcatcccttatcttgtgtattttttatcgttacgttctggggatatatttttttttt-cattatattctcagctttaacctttgcaattcaa |
45456077 |
T |
 |
| Q |
117 |
gatgtatgataaactcttttaaaatgtatgagttt-attttatttggttagtcaggaagattaaaacaaagaaagaatattaatcttttacattttgttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45456076 |
gatgtatgataaactcttttaaaatgtatgagttttattttatttggttagtcaggaagattaaaacaaagaaagaatattaatcttttacattttgttt |
45455977 |
T |
 |
| Q |
216 |
acaattataaatttagtttgtttttctgattgaatttaatgttattgtgatgtgttgtgtgtgattttgcaaatgaatatatagatgtattcctct |
311 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45455976 |
acaattataaatttagtttgtttttgtgattgaatttaatgttattctgatgtgttgtgtgtaattttgcaaatgaatatatagatgtattcctct |
45455881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University