View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20244_low_25 (Length: 230)

Name: NF20244_low_25
Description: NF20244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20244_low_25
NF20244_low_25
[»] chr4 (1 HSPs)
chr4 (1-228)||(54958186-54958416)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 54958186 - 54958416
Alignment:
1 aggatagggataaggatgatactctgaagatgttgctagaagccaagacaaatgatgcacaagaaccattagctattgcagctgatattggatatgatga 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||    
54958186 aggatagggacaaggatgatactctgaagatgttgctagaagccaagacaagtgatgcacaagaaccattagcaattgctgctgatattggatatgatga 54958285  T
101 gaattgcaaacaggttgtggaacttgttgtcaaagagtatgga---cgcattgatgttcttgtcaacaatgcagctgaacaacacctcaaaaactcaata 197  Q
    |||||| ||||||||||||||||||||||| ||||| ||||||    |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
54958286 gaattgtaaacaggttgtggaacttgttgtaaaagaatatggaagcagcattgatgttcttgtcaacaatgcagctgaacaacacctcagaaactcaata 54958385  T
198 gaggaaatcactgagcaacagcttgaaagag 228  Q
    |||||||||||||| ||||||||||||||||    
54958386 gaggaaatcactgaacaacagcttgaaagag 54958416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University