View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20245_high_5 (Length: 466)
Name: NF20245_high_5
Description: NF20245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20245_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 2e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 148 - 451
Target Start/End: Original strand, 11401878 - 11402180
Alignment:
| Q |
148 |
atatatactcgaaaacatgaaatttgcaaccaaaaataaaataaatgatgcatatctaattatttcgttactttagatcatttcatattttctcttttta |
247 |
Q |
| |
|
||||||||| |||| |||| |||||||| | ||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11401878 |
atatatactagaaatcatggaatttgcagcaaaaaataaaataaatgatgtatatctaattatttcgttattttagattatttcatattttctcttttta |
11401977 |
T |
 |
| Q |
248 |
aattgtcatcgctaagaggtggttgaaacttcgtatcaatatatcatggtaaccnnnnnnnnntttgtcatcgctaattannnnnnnatgnnnnnnnctt |
347 |
Q |
| |
|
|||| ||||| ||| | |||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||| |
|
|
| T |
11401978 |
aattatcatcactatgcggtggtagaaacttcgtatcaatatatcatggtaacaaaaaaaaaaattgtcatcgctaattttttttttatg-aaataactt |
11402076 |
T |
 |
| Q |
348 |
accatcctttgtaatccttaggctctctattggccttcagcagccccatcaattcatcagaagttaaagcacttgggtgtttccgtgcatgcttgctgaa |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
11402077 |
accatcctttgtaatccttaggctctctattggccttcaacagccccatcaattcatcagaagttaaagcacttgggtgttttcttgcatgcttgctgaa |
11402176 |
T |
 |
| Q |
448 |
aatt |
451 |
Q |
| |
|
|||| |
|
|
| T |
11402177 |
aatt |
11402180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 29 - 63
Target Start/End: Original strand, 11401740 - 11401774
Alignment:
| Q |
29 |
gtgcttctaatatggaaaagtgttttttcctcgtc |
63 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
11401740 |
gtgcttctaatatggaaatgtgttttttcctcgtc |
11401774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University