View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20245_high_9 (Length: 219)
Name: NF20245_high_9
Description: NF20245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20245_high_9 |
 | |
|
| [»] scaffold0074 (1 HSPs) |
| | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 24384793 - 24384976
Alignment:
| Q |
30 |
aaaactgtcctcagactcggattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttccgct |
129 |
Q |
| |
|
|||||||||||||||||| |||||| ||| ||||||||||||||||||||||| || ||||||||||||| |||||||||| | | |||||||||| || |
|
|
| T |
24384793 |
aaaactgtcctcagactcagattgctctttctccaaacgagctatcatttggtatgaggagtgcatggttcaatactccaactattatttcttttccact |
24384892 |
T |
|
| Q |
130 |
gttgccatttatccttggctttacatgtggaacgtaggcaacgtatctaacacaaaaagcttcatgcctttattttcttcgaca |
213 |
Q |
| |
|
||||| || |||| |||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
24384893 |
gttgcaatacgtcctgggctttacatgtggaacgcaggcaacatatctaacacaaaaagcttcatggctttattattttcgaca |
24384976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 20128301 - 20128188
Alignment:
| Q |
19 |
aatgcaacagcaaaactgtcctcagactcggattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctt |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
20128301 |
aatgcaacagaaaaactgtcctcagactcggattgccatttatccaaacgagctgtcatttggtacgaggagtgcatggttcgatactccaacacctctt |
20128202 |
T |
|
| Q |
119 |
tcttttccgctgtt |
132 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
20128201 |
tcttttccactgtt |
20128188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 22204569 - 22204682
Alignment:
| Q |
19 |
aatgcaacagcaaaactgtcctcagactcggattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctt |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
22204569 |
aatgcaacagaaaaactgtcctcagactcggattgccatttatccaaacgagctgtcatttggtacgaggagtgcatggttcgatactccaacacctctt |
22204668 |
T |
|
| Q |
119 |
tcttttccgctgtt |
132 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
22204669 |
tcttttccactgtt |
22204682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 126
Target Start/End: Complemental strand, 20205872 - 20205807
Alignment:
| Q |
61 |
tccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttcc |
126 |
Q |
| |
|
||||||| |||| | |||||||||| |||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
20205872 |
tccaaacaagctgtgatttggtacggcgagtgcatggttcgatactctaacatatctttcttttcc |
20205807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 126
Target Start/End: Complemental strand, 21972433 - 21972368
Alignment:
| Q |
61 |
tccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttcc |
126 |
Q |
| |
|
||||||| |||| | |||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21972433 |
tccaaacaagctgtgatttggtacggcgagtgcatggttcgattctctgacaactctttcttttcc |
21972368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 126
Target Start/End: Complemental strand, 22099895 - 22099830
Alignment:
| Q |
61 |
tccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttcc |
126 |
Q |
| |
|
||||||| |||| | |||||||||| |||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
22099895 |
tccaaacaagctgtgatttggtacggcgagtgcatggttcgatactctaacatatctttcttttcc |
22099830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 20238358 - 20238314
Alignment:
| Q |
168 |
caacgtatctaacacaaaaagcttcatgcctttattttcttcgac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
20238358 |
caacgtatctaacacaaaaagcttcatgcctatattgttttcgac |
20238314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 22132342 - 22132298
Alignment:
| Q |
168 |
caacgtatctaacacaaaaagcttcatgcctttattttcttcgac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
22132342 |
caacgtatctaacacaaaaagcttcatgcctatattgttttcgac |
22132298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 133
Target Start/End: Complemental strand, 18997360 - 18997276
Alignment:
| Q |
49 |
gattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttccgctgttg |
133 |
Q |
| |
|
||||||| ||||||||||| ||| |||||| ||||| ||||| | ||||| |||||| |||||| |||||||||| |||||| |
|
|
| T |
18997360 |
gattgccctttatccaaacaagcagtcatttattacgacgagtgtaatgttcgttactcctacaactatttcttttccactgttg |
18997276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 133
Target Start/End: Complemental strand, 20086564 - 20086480
Alignment:
| Q |
49 |
gattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttccgctgttg |
133 |
Q |
| |
|
||||||| |||||||||| |||| | |||| ||||| | ||||||||||||||||||| | | |||||||||||| |||||| |
|
|
| T |
20086564 |
gattgcccattatccaaacaagctgtaatttattacgaaaattgcatggttcgatactccagcgagtctttcttttccactgttg |
20086480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 119
Target Start/End: Original strand, 47634876 - 47634937
Alignment:
| Q |
58 |
ttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactcttt |
119 |
Q |
| |
|
|||||||||| |||| | || |||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
47634876 |
ttatccaaacaagctgtaatctggtacgacgagtgcatggttcgatattccaacacctcttt |
47634937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0074 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0074
Description:
Target: scaffold0074; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 47428 - 47505
Alignment:
| Q |
49 |
gattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttcc |
126 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||| || | |||||||||||||||||||| | |||||||||||| |
|
|
| T |
47428 |
gattgcccattatccaaagaagctattatttggtatgacaattgcatggttcgatactccaatgagtctttcttttcc |
47505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 133
Target Start/End: Original strand, 4931 - 5015
Alignment:
| Q |
49 |
gattgccatttatccaaacgagctatcatttggtacgatgagtgcatggttcgatactccaacaactctttcttttccgctgttg |
133 |
Q |
| |
|
||||||| |||||||||| |||| | |||| ||||| | |||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
4931 |
gattgcccattatccaaacaagctgtaatttattacgaaaattgcatggttcgatactccaatgagtctttcttttccactgttg |
5015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University