View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20246_low_11 (Length: 306)
Name: NF20246_low_11
Description: NF20246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20246_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 10 - 290
Target Start/End: Complemental strand, 4316796 - 4316516
Alignment:
| Q |
10 |
aagaatatggcactttataggaacacttttcagcattatcttcttactcttttcaataatcttaacttggtggttcttgtttcttgttcctttgtctttt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316796 |
aagaaaatggcactttataggaacacttttcagcattatcttcttactcttttcaataatcttaacttggtggttcttgtttcttgttcctttgtctttt |
4316697 |
T |
|
| Q |
110 |
tatggatttgctttgtatagtcatttgttcattgaagagaattttcctgtgactattggatatccattttggtctctttattgtgatttgaagttgtttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316696 |
tatggatttgctttgtatagtcatttgttcattgaagagaattttcctgtgactattggatatccattttggtctctttattgtgatttgaagttgtttt |
4316597 |
T |
|
| Q |
210 |
ggtttatggttagtgggaaaatggatagagagattaaaagacttgggaagagacctgtgttgcaattcttatgatgatttt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316596 |
tgtttatggttagtgggaaaatggatagagagattaaaagacttgggaagagacctgtgttgcaattcttatgatgatttt |
4316516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 274
Target Start/End: Original strand, 24363081 - 24363279
Alignment:
| Q |
76 |
ttggtggttcttgtttcttgttcctttgtctttttatggatttgctttgtatagtcatttgttcattgaagagaattttcctgtgactattggatatcca |
175 |
Q |
| |
|
||||||||| ||||| |||||||||| ||| |||||||| ||||| |||||||||||| || |||| ||||| |||| | ||| |||| |||| |
|
|
| T |
24363081 |
ttggtggtttttgttgtttgttcctttatctggttatggatgtgcttggtatagtcatttctttgttgagaagaatgttccagctacttttggtcatccc |
24363180 |
T |
|
| Q |
176 |
ttttggtctctttattgtgatttgaagttgttttggtttatggttagtgggaaaatggatagagagattaaaagacttgggaagagacctgtgttgcaa |
274 |
Q |
| |
|
|||||||| ||| ||||||| ||| ||||| |||| ||| ||| ||| |||||||||||||||| || || ||||| || ||||||||||||||| |
|
|
| T |
24363181 |
ttttggtcgtttttgtgtgattataagatgtttgggttgatgcttactggacaaatggatagagagatcaagaggcttggaaaaagacctgtgttgcaa |
24363279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University