View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20247_low_3 (Length: 398)
Name: NF20247_low_3
Description: NF20247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20247_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 19 - 387
Target Start/End: Complemental strand, 279452 - 279084
Alignment:
| Q |
19 |
tccattgggtcggatgtccatgaccactcgggagagtttcctaatttttgatgtagttgcttcatataaatatttgtttgtgcttccgtctttgcagtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
279452 |
tccattgggtcggatgtccatgaccactcgggcgagtttcctaatttttgatctagttgcttcatataaatatttgtttgtgcttcagtctttgcagtgt |
279353 |
T |
|
| Q |
119 |
tgtaaacttctttgttgcagtcttggagaagggacattgaccaagcagaaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279352 |
tgtaaacttctttgttgcagtcttggagaagggacattgaccaagcaggaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggt |
279253 |
T |
|
| Q |
219 |
atgtgaattactcaaaaaacaaattttttgtccagtgtccttatttgtataagtagtcatccataaataatctccatgactctcccaagtagcagtgcca |
318 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
279252 |
atgtgaattactcaaaaaacaaaatttttgtccagtgcccttatttgtataagtagtcatccataaagaatctccatgactctcccaagtagcagtgcca |
279153 |
T |
|
| Q |
319 |
ttggtacgaaccttctctcctaactttatggcagcatggagtcttttaagatgtccatattttggttca |
387 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279152 |
ttggtgagaaccttctctcctaactttatggcagcatggagtcttttaagatgtccatattttggttca |
279084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University