View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20247_low_5 (Length: 329)
Name: NF20247_low_5
Description: NF20247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20247_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 17744808 - 17745120
Alignment:
| Q |
1 |
aataatcaactgcacttgcagttaccacactccattcaatgcttgcttcacttggtgcataaaaatttggactagtgcaaccagaagcaacatgtgatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17744808 |
aataatcaactgcacttgcagttaccacactccattcaatgcttgcttcacttggtgcataaaaatttggactagtgcaaccagaagcaacatgtgatgt |
17744907 |
T |
|
| Q |
101 |
tgttgttcttgataaaaatgagcttgttttattaccagtgaaactttcaatctcaaataaatctgaacttgcatcacttccaannnnnnnnnnnnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17744908 |
tgttgttcttgataaaaatgagcttgttttattaccagtgaagctttcaatctcaaataaatctgaacttgcatcacttccaacatcatcatcatcatca |
17745007 |
T |
|
| Q |
201 |
nnncaatttgtagaaaaatcaatttcttgttcttcaagtttagtagcagcttcccaagatggtatttttagcctcatatcaaagcttattgacttgcatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17745008 |
tcacaatttgtagaaaaatcaatttcttgttcttcaagttttgaagcagcttcccaagatggtatttttagtctcatatcaaagcttattgacttgcatc |
17745107 |
T |
|
| Q |
301 |
tttcatctaatat |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17745108 |
tttcatctaatat |
17745120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 179
Target Start/End: Complemental strand, 24336907 - 24336875
Alignment:
| Q |
147 |
tcaatctcaaataaatctgaacttgcatcactt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24336907 |
tcaatctcaaataaatctgaacttgcatcactt |
24336875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 24337042 - 24337002
Alignment:
| Q |
12 |
gcacttgcagttaccacactccattcaatgcttgcttcact |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
24337042 |
gcacttgcagttaccacactccattctatgcttgcctcact |
24337002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University