View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20248_high_25 (Length: 229)
Name: NF20248_high_25
Description: NF20248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20248_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 104 - 223
Target Start/End: Original strand, 1172330 - 1172449
Alignment:
| Q |
104 |
ttcttatagtaagagatagttcatgtttgtgatcattctgactttccacgaacccatcgttttggttcaaagcctgagcacttgagatcatcaataggaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1172330 |
ttcttatagtaagagatagttcatgtttgtgatcattccgactttccacgaacccatcgttttggttcaaagcttgagcacttgagatcatcaataggaa |
1172429 |
T |
 |
| Q |
204 |
gagtacagaaagtattatct |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1172430 |
gagtacagaaagtattatct |
1172449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 1164972 - 1165088
Alignment:
| Q |
104 |
ttcttatagtaagagatagttcatgtttgtgatcattctgactttccacgaacccatcgttttggttcaaagcctgagcacttgagatcatcaataggaa |
203 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||||||| |||||||||| | ||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
1164972 |
ttcttatagtatgggatagttcatgtttgtgatcattccgactttccgcgaacccatcatggtggttcaaagcttgagcacttgagatcatcaatatgaa |
1165071 |
T |
 |
| Q |
204 |
gagtacagaaagtatta |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1165072 |
cagtacagaaagtatta |
1165088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 173
Target Start/End: Original strand, 1160318 - 1160387
Alignment:
| Q |
104 |
ttcttatagtaagagatagttcatgtttgtgatcattctgactttccacgaacccatcgttttggttcaa |
173 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| ||||||||||| |||||||| || |||||||| |
|
|
| T |
1160318 |
ttcttatagtaacagatagttcatgtttgtgtgcattttgactttccacaaacccatctttgtggttcaa |
1160387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University