View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20248_high_5 (Length: 474)

Name: NF20248_high_5
Description: NF20248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20248_high_5
NF20248_high_5
[»] chr5 (1 HSPs)
chr5 (18-460)||(3332147-3332589)
[»] chr8 (1 HSPs)
chr8 (227-307)||(13212814-13212894)
[»] chr1 (3 HSPs)
chr1 (257-305)||(32803230-32803278)
chr1 (257-305)||(16578617-16578665)
chr1 (270-305)||(32809703-32809738)
[»] chr3 (1 HSPs)
chr3 (244-297)||(46200911-46200964)


Alignment Details
Target: chr5 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 18 - 460
Target Start/End: Original strand, 3332147 - 3332589
Alignment:
18 gaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaacagccccaggagaagccggttgccttagtgtcacgtttgtaaccgt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
3332147 gaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaacagctccaggagaagccggttgccttagtgtcacgtttgtaaccgt 3332246  T
118 ccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcaaagttgttgacactttcaacaacgtcacaaccgtctgcaacttccatcacgtga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332247 ccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcgaagttgttgacactttcaacaacgtcacaaccgtctgcaacttccatcacgtga 3332346  T
218 gttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttcttgtcattgaat 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332347 gttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttcttgtcattgaat 3332446  T
318 cggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgag 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332447 cggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgag 3332546  T
418 tccaccgccgctgctacttccgctttgttcatcttgatctgtg 460  Q
    |||||||||||||||||||||||||||||||||||||||||||    
3332547 tccaccgccgctgctacttccgctttgttcatcttgatctgtg 3332589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 227 - 307
Target Start/End: Original strand, 13212814 - 13212894
Alignment:
227 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt 307  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||||    
13212814 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt 13212894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 257 - 305
Target Start/End: Original strand, 32803230 - 32803278
Alignment:
257 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 305  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||||||    
32803230 ggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 257 - 305
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
257 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 305  Q
    |||||||||||||||||||| || || | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 305
Target Start/End: Original strand, 32809703 - 32809738
Alignment:
270 tgtttttggatccagctggtcttcctcttggtcttc 305  Q
    ||||||||||||||| ||||||||||||||||||||    
32809703 tgtttttggatccaggtggtcttcctcttggtcttc 32809738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 244 - 297
Target Start/End: Complemental strand, 46200964 - 46200911
Alignment:
244 tgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctct 297  Q
    |||||||||||| |||||||||||||||||||| || |||| ||| | ||||||    
46200964 tgtgatgataataggtggttttggtttgttttttgagccaggtggacgtcctct 46200911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University