View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20248_low_18 (Length: 248)
Name: NF20248_low_18
Description: NF20248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20248_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 47178740 - 47178535
Alignment:
| Q |
22 |
tggttgagctttgccatcagctagcattttgcgatttttcatttagtagttaagatggaaatgatatggagcgctggattcatcatagggtggatatata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47178740 |
tggttgagctttgccatcagctagcattttccgatttttcatttattagttaggatggaaatgatatggagcgctggattcatcatagggtgg----ata |
47178645 |
T |
 |
| Q |
122 |
ttaggtgaccgcaggttttttatgacagccgtgaatccgaatccatgaaaatcattgttagaagccaagaaaatcacc----aataaatttggtttattt |
217 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
47178644 |
ttaggtgactgcagg-tttttatgacagccgtgaatccgaatccatgaaaatcattgttagaagcgaagaaaatcaccaattaataaatttggtttattt |
47178546 |
T |
 |
| Q |
218 |
ggtcaacgtct |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
47178545 |
ggtcaacgtct |
47178535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 118
Target Start/End: Original strand, 47179016 - 47179050
Alignment:
| Q |
84 |
gatatggagcgctggattcatcatagggtggatat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47179016 |
gatatggagcgctggattcatcatagggtagatat |
47179050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University