View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20248_low_25 (Length: 237)
Name: NF20248_low_25
Description: NF20248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20248_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 3 - 212
Target Start/End: Complemental strand, 39980668 - 39980470
Alignment:
| Q |
3 |
catggtcaaaataatcgttgcttacaaacaccagttattattattttannnnnnnnaacaatatgatcattttagttatacttccaaaaggttggtgtct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39980668 |
catggtcaaaataatcgttgcttacaaacaccagttatttttttt-----------aacaatatgatcattttagttatacttccaaaaagttggtgtct |
39980580 |
T |
 |
| Q |
103 |
tctcaaaccagtgatttttagtataagacataaaatggtcgtaataaaaaaccaaaatgaccggatattatttacgtttttgttaatattaggaaaaaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39980579 |
tctcaaaccagtgatttttagtataagacataaaatggtcgtaataaaaaaccaaaatgaccagatattatttacgtttttgttaatattaggaaaaaac |
39980480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University