View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20249_high_5 (Length: 241)
Name: NF20249_high_5
Description: NF20249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20249_high_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 56 - 241
Target Start/End: Original strand, 19679648 - 19679835
Alignment:
| Q |
56 |
gagattcatttctatgcactgacggtgtaaaacaaatttatgcatgcaaaccacaccataaca--gtggttagttcttaaaacatctctactacacgttg |
153 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
19679648 |
gagattcatttctatgcactaacggcgtaaaacaaatttatgcatgcaagccacaccataacacagtggttagtttttaaaatatctctactacacgttg |
19679747 |
T |
|
| Q |
154 |
agatgcgatgcgattaaataaatttgaaaaaatagatctacacgatcggtgtaaaataaatcaaattcttatagaaaaccagaaataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19679748 |
agatgcgatgcgattaaataaatttgaaaaaatagatctacacgatcggtgtaaaataaatcaaattcttatagaaaaccagaaataa |
19679835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University