View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20249_high_7 (Length: 234)
Name: NF20249_high_7
Description: NF20249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20249_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 163 - 220
Target Start/End: Complemental strand, 12138896 - 12138839
Alignment:
| Q |
163 |
aactcatcacccatgaagagaaaaacacatgcttctttgttgttgttatatagttttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12138896 |
aactcatcacccatgaagagaaaaacacatgcttctttgttgttgttatatagttttt |
12138839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University