View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20249_low_11 (Length: 233)
Name: NF20249_low_11
Description: NF20249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20249_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 8139028 - 8139201
Alignment:
| Q |
16 |
attattcttccgtaacagttctaaagtttctgtggctctcatctaattgttt-atgtatgcactatcagttaatacatggctgactttggaatgatgtct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8139028 |
attattcttccgtaacagttctaaagtttctgtggctctcatctaattgttttatgtatgcactatcagttaatacatggctgactttggaattatgtct |
8139127 |
T |
 |
| Q |
115 |
cagttttgtataaatgatgaatctatgctttggaatgatggatgtctcagttttttatgtttcttgatcattaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8139128 |
cagttttgtataaatgatgaatctatgctttggaatgatggatgtctcagttttttatgtttcttgatcattaa |
8139201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 7499834 - 7499722
Alignment:
| Q |
16 |
attattcttccgtaacagttctaaagtttctgtggctctca-------tctaattgtttatgtatgcactatcagttaatacatggctgactttggaatg |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
7499834 |
attattcttcaataacagttctaaagtttctgtggctctgaagtctgatctaattgtttatatatgcactatctgttaatacatggctggttttagaatg |
7499735 |
T |
 |
| Q |
109 |
atgtctcagtttt |
121 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7499734 |
atgtctcagtttt |
7499722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University