View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20249_low_14 (Length: 218)
Name: NF20249_low_14
Description: NF20249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20249_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 53613502 - 53613713
Alignment:
| Q |
7 |
tagattcgtctttcagcaggtttgataaactttcacaaaactgataatcaaaattaaatcggtaaccatatttatgatcttatgaatattcaattaacag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53613502 |
tagattcgtctttcagcaggtttgataaactttcacaaaactgataatcaaaattaaatcggtaaccatatttatgatcttatgaatattcaattaacag |
53613601 |
T |
|
| Q |
107 |
gatgtgttttcttacctcattatacattcttagatctcctacagattttgatacttgtacaacacaatgagccggagcaacttcaattacctgataattt |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53613602 |
gatatgttttcttacctcattatacattcttagatctcctacagattttgatacttgtacaacacaatgagccggagcaacttcaatcacctgataattt |
53613701 |
T |
|
| Q |
207 |
cgacgtatatat |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53613702 |
cgacgtatatat |
53613713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University