View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024R-Insertion-1 (Length: 365)
Name: NF2024R-Insertion-1
Description: NF2024R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024R-Insertion-1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 34867824 - 34867481
Alignment:
| Q |
12 |
tgatcacttaattccaaatacatcatctctgatgtttttaactta---atgtctagtccttgtaaatattgatggagggatgaaacctggataataattt |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867824 |
tgatcacttaatttcaaatacatcatctctgatgattttaacttattaatgtctagtccttgtaaatattgatggagggatgaaacctggataataattt |
34867725 |
T |
|
| Q |
109 |
acaattatagcgtgatcattttgaaataatgttaacctagcggactaggttgatgcaatcataacatttgacaaacatcccctaccactcaatcacacac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867724 |
acaattatagcgtgatcattttgaaataatgttaacctagcggactaggttgatgcaatcataacatttgacaaacatcccctaccactcaatcacacac |
34867625 |
T |
|
| Q |
209 |
ctgattcactcactagttattgctttcactttatcttattctgaatgaagattttgtttcaatatctaaggtcgttgggcaggtaatatgatgtcttgct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34867624 |
ctgattcactcactagttattgctttcactttatcttattctgaatgaagattttgtttcgctatcaaaggtcgttgggcaggtaatatgatgtcttgct |
34867525 |
T |
|
| Q |
309 |
catatcatatggattggaaattatgtggctgttgctgtttcatt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867524 |
catatcatatggattggaaattatgtggctgttgctgtttcatt |
34867481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 38382010 - 38382071
Alignment:
| Q |
282 |
gttgggcaggtaatatgatgtcttgctcatatcatatggattggaaattatgtggctgttgc |
343 |
Q |
| |
|
||||| |||||||| || ||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
38382010 |
gttggtcaggtaatctggtgtcttgctcatacaatttggattggaaattctgtggctgttgc |
38382071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University